-
-
Save Colelyman/a4be3a4742d4ac9aece190f20441200f to your computer and use it in GitHub Desktop.
Simulate paired reads with adapter readthrough and substitutions for testing adapter trimming and read merging
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import random | |
simulate_deletion_lens = range(30) #deletions to simulate - here, 0 to 30bp deletions. The longer the deletion, the more adapter will be included in the read | |
simulate_mismatch_counts = range(3) #number of mismatches to simulate - her, 0, 1, and 2 mismatches between r1 and r2. The higher the number of mismatches, the less likely the read will be merged. | |
read_len = 210 #length of reads to generate | |
read = ' CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG ' | |
readthrough = 'ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGGAGATCGGAAGAGCACACGTCTGAACTCCAGTCA' | |
complement = {'A': 'T', 'C': 'G', 'G': 'C', 'T': 'A'} | |
nucleotides = list(complement.keys()) | |
def rev_comp(seq): | |
bases = list(seq) | |
bases = [complement[base] for base in bases] | |
return ''.join(bases[::-1]) | |
start_spaces = 0 | |
for i in range(len(read)): | |
if read[i] == ' ': | |
start_spaces += 1 | |
else: | |
break | |
end_spaces = 0 | |
for i in range(len(read)-1,0,-1): | |
if read[i] == ' ': | |
end_spaces += 1 | |
else: | |
break | |
indel_loc = 80 + start_spaces | |
print(f"5' adapter length: {start_spaces}") | |
print(f"3' adapter length: {end_spaces}") | |
end_loc = len(readthrough)-end_spaces | |
#with 210 read length, any more than 13bp deletion will result in adapter readthrough | |
max_indel_no_adapter = len(read.replace(' ','')) - read_len | |
print(f'Only reads with deletions longer than {max_indel_no_adapter}bp will have adapter readthrough') | |
print('Starting simulation') | |
file_root = 'makeSims.py.read_length_'+str(read_len) | |
read_id = 0 | |
with open(file_root+".r1.fq",'w') as f1out, open(file_root+".r2.fq",'w') as f2out: | |
for indel_len in simulate_deletion_lens: | |
for num_mismatches in simulate_mismatch_counts: | |
readthrough_copy = readthrough[0:indel_loc] + readthrough[indel_loc+indel_len:] | |
copy_end_loc = len(readthrough_copy)-end_spaces | |
sim_read1 = readthrough_copy[start_spaces:start_spaces+read_len] | |
sim_read2 = readthrough_copy[copy_end_loc-read_len:copy_end_loc] | |
sim_read2 = rev_comp(sim_read2) | |
sub_locs = random.sample(range(len(sim_read2)),num_mismatches) | |
for sub_loc in sub_locs: | |
sim_read2 = sim_read2[0:sub_loc]+complement[sim_read2[sub_loc]] + sim_read2[sub_loc+1:] | |
expected_adapter_len = max(0,indel_len-max_indel_no_adapter) #how much adapter will be at the end of the read | |
this_id = f'@sim_read_{read_id}__indel_len_{indel_len}__expected_adapter_{expected_adapter_len}__sub_locs_'+','.join([str(x) for x in sub_locs]) | |
this_qual = 'A'*len(sim_read1) | |
f1out.write(f'{this_id}\n{sim_read1}\n+\n{this_qual}\n') | |
f2out.write(f'{this_id}\n{sim_read2}\n+\n{this_qual}\n') | |
read_id += 1 | |
print(f'Finished. Printed {read_id} simulations.') | |
print('Writing single-end file with trimming required') | |
read_id = 0 | |
with open(file_root+".single_end_trim_reqd.r1.fq",'w') as f1out: | |
for i in range(100): | |
random_bases = ''.join(random.choices(nucleotides,k=5)) | |
sim_read1 = readthrough[start_spaces:] + random_bases | |
this_id = f'@sim_read_{read_id}' | |
this_qual = 'H'*len(sim_read1) | |
f1out.write(f'{this_id}\n{sim_read1}\n+\n{this_qual}\n') | |
read_id += 1 | |
print('Finished') | |
print('Writing paired-end file with trimming required') | |
read_id = 0 | |
with open(file_root+".paired_end_trim_reqd.r1.fq",'w') as f1out, open(file_root+".paired_end_trim_reqd.r2.fq",'w') as f2out: | |
for i in range(100): | |
random_bases = ''.join(random.choices(nucleotides,k=5)) | |
sim_read1 = readthrough[start_spaces:] + random_bases | |
copy_end_loc = len(readthrough)-end_spaces | |
sim_read2 = readthrough[0:copy_end_loc] | |
random_bases = ''.join(random.choices(nucleotides,k=5)) | |
sim_read2 = rev_comp(sim_read2) + random_bases | |
this_id = f'@sim_read_{read_id}' | |
this_qual = 'H'*len(sim_read1) | |
f1out.write(f'{this_id}\n{sim_read1}\n+\n{this_qual}\n') | |
f2out.write(f'{this_id}\n{sim_read2}\n+\n{this_qual}\n') | |
read_id += 1 | |
print('Finished') | |
print('Writing paired-end file with merging required') | |
read_id = 0 | |
with open(file_root+".paired_end_merge_reqd.r1.fq",'w') as f1out, open(file_root+".paired_end_merge_reqd.r2.fq",'w') as f2out: | |
for i in range(100): | |
sim_read1 = readthrough[start_spaces:start_spaces+read_len] | |
copy_end_loc = len(readthrough)-end_spaces | |
sim_read2 = readthrough[copy_end_loc-read_len:copy_end_loc] | |
sim_read2 = rev_comp(sim_read2) | |
this_id = f'@sim_read_{read_id}' | |
this_qual = 'H'*len(sim_read1) | |
f1out.write(f'{this_id}\n{sim_read1}\n+\n{this_qual}\n') | |
f2out.write(f'{this_id}\n{sim_read2}\n+\n{this_qual}\n') | |
read_id += 1 | |
print('Finished') |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment